Skip to content

SynBioSuite Tutorial Resources

Jump to bottom
Daniel Fang edited this page Jun 12, 2026 · 11 revisions

Filling Out a Resources Excel Workbook

This tutorial walks you through filling out the Resources workbook in Microsoft Excel. You will work in the visible sheets, enter a few example resources, and check that each row is clear and internally consistent. Work at your own pace and return to these instructions whenever you need to know how to fill out a field.

Important

The most important rule is simple: names are for people, IDs are for links. A name is a human-readable label. An ID is a stable value other rows and sheets point to.

1. Set the Scope

You are only filling out the Resources workbook. The workbook is organized by resource type, so each sheet holds one kind of resource. The main sheets are promoter, rbs, cds, terminator, other, protein, complex, signal, chassis, media, and chemicals.

2. Workbook Orientation

Start on the welcome sheet. This is the cover page for the resource collection. If any metadata fields are blank, fill them with real information, for example:

  • Author: Carolus Vitalis
  • Email: carolus@example.org
  • Description: Curated resources for a melanin pathway workbook exercise

Each tab along the bottom is a table for one type of resource. Use the most specific tab that fits the item: a coding sequence belongs on cds, its protein product belongs on protein, and a small molecule belongs on chemicals.

Hover over a column header such as Part Name, Source Organism, or Sequence. The header notes explain what each column expects.

Warning

Some columns are calculated or reserved, such as length (bp), URI, Update, and the URL checker columns. Do not overwrite those formulas during normal entry.

3. Universal Fields

Most sheets repeat the same basic pattern: ID, Name, Previous Version, Description, Data Source, PubMed ID, DOI, and sometimes sequence-specific fields.

Field How to fill it
Name Human-readable label, such as tyrosinase CDS.
ID Stable link value, such as tyrosinase_cds. Keep IDs unique.
Previous Version Leave blank unless this row replaces an older resource URI.
Description Short explanation of what the resource is and why it matters.
Data Source Direct source URL, such as an NCBI or PubChem page.
PubMed ID Numeric PubMed identifier only, such as 12345678.
DOI DOI string or DOI URL, such as https://doi.org/10.1000/example.

Tip

Blank is better than invented information. If you do not know the previous version, source, PubMed ID, or DOI, leave that field empty until the evidence is available.

4. Enter a Linked CDS and Protein

In this step you enter a coding sequence and link it to the protein it encodes.

CDS row

Go to the cds sheet and select the first blank row under the headers. Enter:

  • Part Name: tyrosinase CDS
  • Part ID: tyrosinase_cds, if the ID cell is editable. If the workbook fills the ID from the name, leave the formula in place and keep the naming consistent.
  • Part Description: Coding sequence for tyrosinase used in melanin biosynthesis
  • Source Organism: choose Streptomyces antibioticus from the dropdown if available, or enter the accepted organism text for the workbook.
  • Encodes for: tyrosinase
  • Sequence: ATGGCTTACGGTAAG

After you enter the sequence, check that length (bp) updates.

Important

The Encodes for value is not a display name. It is the ID of the protein row you enter next, typed exactly.

Protein row

Go to the protein sheet and select the first blank row. Enter:

  • Protein Name: tyrosinase
  • Protein ID: tyrosinase
  • Protein Description: Protein product encoded by tyrosinase_cds
  • Sequence: MAYGK

Now compare the two sheets: on cds, Encodes for is tyrosinase, and on protein, Protein ID is tyrosinase. They match exactly. This is the key workbook habit: when one sheet refers to another resource, type the target ID exactly.

5. Quick Examples on Other Sheets

Promoter

On the promoter sheet, enter:

  • Part Name: melA promoter
  • Part ID: mela_promoter
  • Activators: melR
  • Sequence: TTGACATATATTAAT

Use Activators and Repressors for the IDs of regulatory components. If the workbook appends dropdown selections, use that feature. Otherwise, type comma-separated IDs manually.

Other DNA part

On the other sheet, enter:

  • Part Name: lac operator
  • Part ID: lac_operator
  • Role: choose operator if available.
  • Sequence: AATTGTGAGCGGATAACAATT

Use other only when the DNA part does not fit promoter, RBS, CDS, or terminator. The Role field explains what kind of part it is.

6. Experimental Resources

On the chassis sheet, enter:

  • Chassis Name: E. coli MG1655
  • Chassis ID: ecoli_mg1655
  • Chassis Description: Laboratory Escherichia coli strain used as a host chassis

On the media sheet, enter:

  • Media Name: M9 glucose
  • Media ID: m9_glucose
  • Media Description: M9 minimal medium supplemented with glucose

On the chemicals sheet, enter:

  • Chemical Name: L-tyrosine
  • Chemical ID: l_tyrosine
  • Chemical Description: Melanin pathway precursor
  • Data Source: https://pubchem.ncbi.nlm.nih.gov/compound/6057

These sheets matter because later workbook users may reuse the exact same chassis, medium, chemical, or signal IDs. Stable IDs make that reuse possible.

7. Final Quality Check

Before saving, review your work against this checklist:

  • Every filled row has a readable name.
  • Every filled row has a unique ID.
  • Cross-sheet fields use IDs, not names.
  • Descriptions explain the resource.
  • Known evidence fields are filled, and unknown evidence is left blank.
  • DNA and protein sequences use the right alphabet.
  • Length columns update after sequence entry.
  • Dropdown-backed fields use accepted values.
  • Formula and checker columns have not been overwritten.
  • Empty rows are fully blank.

If those checks pass, the Resources workbook is ready for the next person to review or reuse.

Downloads

Connecting Excel to SynBioHub through SynBioSuite

  1. Go to https://synbiosuite.org.
  2. Click on Use my local file system through Chrome
  3. On the left panel, click on Resources, then Open Folder.

resourcesdan1

  1. Create a new Folder in your IWBDA folder or another folder of your choice. We will call this folder, IWBDADemo2026.

resourcesdan2

  1. Click on synbiohub.org and click on Login in the embedded window.

resourcesdan4

  1. Enter your credentials for the account you created earlier and then click login. If you haven't created an account, click on Register first, fill in the required fields, then login afterwards.
  2. Next, select Import Resources and select the Excel Sheet you created earlier.
  3. After, we have to Select the repository we want to connect our Excel data to. For the repository, select dev2.synbiohub.org.
  4. Click on Verify Credentials then Login.
  5. Enter your SynBioHub credentials again and then login. Click Confirm & Continue.
  6. The next step is we need to create a collection for our parts. Click on Create Collection.
  7. Enter information for the collection. See the screenshot for what to enter.

resourcesdan5

  1. Once the collection is created, find it in your collection list and click confirm selection.
  2. Now, the files have been imported into SynBioHub. On the left, click on dev2.synbiohub.org.
  3. Navigate to the collection you created through Submissions and resources.
  4. Congrats you have imported an SBOL Collection from Excel into SynBioHub! Take the rest of the time to explore SynBioHUb.

Clone this wiki locally