Skip to content

Repository files navigation

logan_blaster: Blast a query against Logan data

GitHub release install with bioconda

Align genomic sequences with Logan contigs or unitigs.

Two main modes

  1. From a query and a list of Logan accessions.
  2. From a Logan-Search session id. The query and Logan accessions are then automaticaly retreived.

In any case, for each accession, logan_blaster

  1. Downloads the Logan contigs,
  2. Computes coverage statistics (mean, median) of the downloaded contigs,
  3. Recruits contigs that contain at least one shared k-mer (k=17 by default) with the query (uses back_to_sequences),
  4. Computes coverage statistics (mean, median) of the recruited contigs (uses count_logan_tig_coverage),
  5. Runs a local blast between the query and this subset of contigs.
  6. Analyses the blast results: prints the portion(s) of the query matched by at least one contig of the accession

Install

From conda / mamba

conda create -n logan_blaster -c conda-forge -c bioconda logan_blaster
conda activate logan_blaster

From sources

Requires

Clone the repository

git clone https://github.com/pierrepeterlongo/logan_blaster
cd logan_blaster

# Use the py script: 
python logan_blaster.py --help

Usage

logan_blaster -h
usage: logan_blaster [-h] [-s SESSION] [-a ACCESSIONS] [-q QUERY] [-u] [-k KMER_SIZE] [-l LIMIT] [-d]

Process Logan session or accession/query files.

options:
  -h, --help            show this help message and exit
  -s, --session SESSION
                        Logan session ID
  -a, --accessions ACCESSIONS
                        Path to accessions.txt file or a .csv file 
                        (containing a first header line, ignored, 
                        and storing accessions as the first column)
  -q, --query QUERY     Path to query fasta file
  -u, --unitigs         Use unitigs instead of contigs
  -k, --kmer-size KMER_SIZE
                        K-mer size for sequence recruitment
  -l, --limit LIMIT     Limit number of accessions to process
  -d, --delete          Delete intermediate files after processing

Examples

Example running from session.

logan_blaster -s kmviz-b2bce461-ca13-4a45-b0b4-6c894eacf103

Example running from accessions and query files.

This usage enables to select specific accessions to process, also ordering them, and to provide any custom query file.

logan_blaster  -a example/accessions.txt -q example/query.fa

Note, the -a option also accepts .csv files directly downloaded from the logan-search interface

logan_blaster  -a my_data.csv -q example/query.fa

Output

Created files and directories

The program creates a directory named either with the session name (if run from a session id) or with the query file name (if run from accessions and query files). Here this the structure of this directory (here with two successful accessions on which the query was aligned):

.
|-- alignments
|   |-- my_query_vs_SRR1608527.txt
|   |-- my_query_vs_SRR1608810.txt
|   |-- synth_my_query_vs_SRR1608527.txt
|   |-- synth_my_query_vs_SRR1608810.txt
|-- failed_accessions.txt
|-- input_data
|   |-- num_accession.txt
|   `-- seq.fa
`-- logan_data
    |-- SRR1608527.contigs.fa.zst
    |-- SRR1608527.recruited_contigs.fa
    |-- SRR1608810.contigs.fa.zst
    |-- SRR1608810.recruited_contigs.fa

Interpretation of the results

  • The failed_accessions.txt file contains the list of accessions on which the query was not aligned (or not existing on logan data).
  • In the input_data directory,
    • seq.fa is the query fasta file,
    • num_accession.txt is the accessions file.
  • In the logan_data directory,
    • files named <ACCESSION>.contigs.fa.zst are the downloaded Logan contigs,
    • files named <ACCESSION>.recruited_contigs.fa are the contigs that were recruited because they share at least one k-mer with the query (found thanks to back_to_sequences).
  • In the alignments directory,
    • files named my_query_vs_<ACCESSION>.txt contain the blast alignments between the query and the recruited contigs from accession <ACCESSION>.
    • files named synth_my_query_vs_<ACCESSION>.txt contain a synthesis of these alignments, indicating for each position of the query how many contigs aligned to it (see below).

Synthesis of the alignments

In the alignments directory, files named synth* contain this piece of information:

query    1  CTTCCCTCTAGAACGGGACGAGGTGATGCCCCCACCCATCTCGCACCCCCCATGTGAAAGGCTCACATTCCCGAAGGGGC
            ---aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaabbbbbbbbbbbbbbbbb

query   81  TTCCCTGGGCTCCGAAGGTCAGGGAGAAGGATATTGAGATGTTCCTTGAAAACAGTCGCAGCAAATTCATTGGCTACACG
            aaaaaaaaaaaabbbbbbbbbcccccccccbbbbbcdddccccccdddddddccbbaaaaaaaaaaaaaaaaaaaaaaaa

In this case, except for the first three nucleotides, the full query was aligned to at least one contig. Some portions were aligned to two contigs (positions labeled 'b'), or three contigs (positions labeled 'c'), and so on. All positions aligned to more than 26 contigs are labeled 'Z'.

Tests

The test suite uses pytest and is organised in two files:

File Content External tools required
tests/test_blast_parser.py Unit tests for all blast-parser functions none
tests/test_integration.py Pipeline integration tests with local and remote data blastn, back_to_sequences, zstd

Running the tests

# Unit tests + local integration tests (no network, ~3 s)
pytest

# Include network tests (download one Logan accession)
pytest --network

Test categories

Unit tests (test_blast_parser.py) — always fast, no external tools:

  • TestGetQueryACGT — FASTA reading (single sequence, multiline, multi-record)
  • TestGetQueryName / TestGetQueryLength — blast output header parsing
  • TestParseBLASTN — position-coverage vector: spot-checks on known overlaps (single, double, triple coverage computed from tests/data/self_blast.txt)
  • TestRunBlastParser — byte-exact comparison of the full visualisation output against tests/data/expected_self_synth.txt

Local integration tests (test_integration.py, no network):

  • TestRunBlast — calls _run_blast() with the query aligned against itself; verifies that the blastn and synth files are created and match the reference
  • TestFullPipelineLocal — runs the complete _process_accessions() loop with a pre-placed .fa.zst file (the query compressed with zstd); checks file creation, synth content, and absence of failed accessions

Network integration tests (test_integration.py, --network flag required):

  • TestFullPipelineNetwork — downloads the first accession from example/accessions.txt and verifies output structure and synth format

Reference test data

tests/
├── data/
│   ├── self_blast.txt           blastn output: example/query.fa vs itself
│   └── expected_self_synth.txt  reference synth visualisation (byte-exact)
├── conftest.py                  shared fixtures and --network option
├── test_blast_parser.py
└── test_integration.py

self_blast.txt and expected_self_synth.txt are committed and serve as the non-regression baseline. Regenerate them if the query file or blastn parameters change:

# Regenerate self_blast.txt
blastn -query example/query.fa -subject example/query.fa \
       -out tests/data/self_blast.txt \
       -outfmt 0 -sorthits 0 -word_size 11 -gapextend 2 -gapopen 5 -reward 2 -penalty -3

# Regenerate expected_self_synth.txt
python3 -c "
import sys, io, contextlib
sys.path.insert(0, '.')
from logan_blaster import run_blast_parser
buf = io.StringIO()
with contextlib.redirect_stdout(buf):
    run_blast_parser('example/query.fa', 'tests/data/self_blast.txt', abundance=True)
open('tests/data/expected_self_synth.txt', 'w').write(buf.getvalue())
"

Versioning

Versions follow Semantic Versioning and are driven by git tags. The version displayed by logan_blaster --version is derived automatically from the latest tag.

Authors

About

Given either a kmviz id (obtained from a Logan-Search query) or a query (fasta sequence), and a file containing a list of SRA accessions (provided or not by Logan-Search results) run a local blast between the query and the subset of contigs or unitigs containing at least one shared k-mer with the query.

Resources

Stars

Watchers

Forks

Releases

Packages

Contributors

Languages