Hi,
A gene has acquired a joint junction mutation at position 1610595, as identified by breseq. According to the reference sequence of that gene the sequence between 1610488 and 1610595 contains four out of seven repeats of the sequence 'GAAGATGGCTACTAAGGAAGACCTCCA'.
I assumed that if a new junction occurred, I would find the remaining three repeats of the seven in the newly joined sequence. However, I was unable to find the remaining repeats in the new joint sequence. Additionally, I could not match any part of the newly joined sequence to the reference genome.
My question is: Why did breseq report this mutation as "(GAAGATGGCTACTAAGGAAGACCTCCA)4→8"? Could this be a misinterpretation by breseq? And what might have actually happened to the remaining repeats?
the mutation:

part of the newly joint sequence

Thank you in advance,
Hi,
A gene has acquired a joint junction mutation at position 1610595, as identified by breseq. According to the reference sequence of that gene the sequence between 1610488 and 1610595 contains four out of seven repeats of the sequence 'GAAGATGGCTACTAAGGAAGACCTCCA'.
I assumed that if a new junction occurred, I would find the remaining three repeats of the seven in the newly joined sequence. However, I was unable to find the remaining repeats in the new joint sequence. Additionally, I could not match any part of the newly joined sequence to the reference genome.
My question is: Why did breseq report this mutation as "(GAAGATGGCTACTAAGGAAGACCTCCA)4→8"? Could this be a misinterpretation by breseq? And what might have actually happened to the remaining repeats?
the mutation:

part of the newly joint sequence

Thank you in advance,