Skip to content

Repository files navigation

RNA Interaction Format (RIF)

The RNA Interaction Format (RIF) is focused on capturing RNA interactions in a convenient to use format. It has been developed on the basis of JSON to store RNA-RNA, Protein-RNA or multi Protein/RNA complexes.

RIF uses the JSON schema draft 2020-12 for validation of correctly formatted RIF files.

Overview

The top-level interaction object represents a single RNA-centric interaction object consisting of the name/value pairs version, ID, class, type, evidence and partners.

element value description
version string Currently used format of the interaction (e.g., RIFv1.0)
ID string unique identifier of the interaction used as reference
class keyword class of the interaction: RNA-RNA, Protein-RNA or Protein-RNA-RNA
type string chemical nature of the interaction
evidence list of objects data supporting the interaction
partners list of objects transcript interaction

Version, ID, Class and Type

The name/value pairs ID, class and type describe general information about the interaction and are mandatory.

evidence

An interaction object should contain at least one evidence object. Therefore, the name/value pair evidence is an ordered list of the evidence objects. This consists of the mandatory name/value pairs type, method, data that provide supporting evidence for the interaction. The type name/value pair describes the broad type of evidence. It should be a distinct term, like the type of experiment (e.g., prediction, pull-down assay, overexpression). In that regard, method declares the technique by which the supporting evidence for the interaction has been detected. This can either be computational tools (e.g., RNAcofold, RNAnue, IntaRNA) or laboratory techniques (e.g., qPCR). In the former, the optional name/value pair command specifies the command line call. Moreover, the name/value pair data specifies the actual evidence and can be arbitrary name/value pairs (e.g., values, DOI).

partners

The name/value pair partners is a list of elements that correspond to the RNAs/Proteins involved in an interaction. These contains the mandatory name/value pairs name, symbol, type, local_sites. Other pairs include sequence_type, genomic_coordinates, organism_name and organism_acc and local_sites. The name name/value pair corresponds to the principal name of the gene/transcript and the symbol corresponds to its scientific name. However, this may include unannotated transcript with arbitrary naming. In that regard, type depicts the type of the interaction partner. These are terms that are specified in the sequence ontology and may match the entries in the corresponding annotations (.gff/gtf) file. The genomic_coordinates name/value pair depicts the coordinates of the transcript on the genome in the format chromosome:strand:start-end. In the organism_name name/value pair, the scientific organisms name is stated with organism_acc being the corresponding accession number. The local_sites name/value pair is specified as an object with keys corresponding to the symbols of the interacting transcripts. The values are lists of 2-element lists specifying start and end of the interaction site.

name value mandatory description
name string yes Name of the gene/transcript/protein
symbol string yes (Scientific) Naming of the gene/transcript/protein
type string yes Type of the interaction partner, terms as defined in sequence ontology
genomic_coordinates string yes Coordinates on the genome in the form chromosome:strand:start-end
organism_name string yes Name of the organism the gene/transcript/protein belongs to
organism_acc string yes Corresponding accession number of the organism (e,g., DDBJ/EMBL/GenBank, RefSeq, UniProt)
local_sites list of list yes Interaction sites between the partners

Moreover, info is a nested name/value pair that determines optional properties of the interaction partner. These include the name/value pairs description, sequence and structure. Arbirtrary name-value pairs can be specified as well.

name value mandatory description
description string no Details on the function of the gene/transcript/protein
sequence string no Sequence of the gene/transcript/protein as specified in genomic_coordinates
structure string no Representation of the RNA secondary structure
note string no Arbitrary information

In addition, the custom name/value pair allows to specify user-defined name/value pairs.

Functionality

BED Export

Data in RIF can be exported to BED format. For that, the columns of the BED file are specified as follows:

column title description
1 chrom chromosome name, any valid sequence region name can be used
2 chromStart start coordinate of the feature
3 chromEnd end coordinate of the feature
4 name symbols of the interacting elements, linked using '-'
5 score unused, set to 0
6 strand Strand orientation of the feature
7 thickStart unused, set to chromStart
8 thickEnd unused, set to chromEnd
9 itemRgb class of the interaction
10 blockCount number of interaction sites
11 blockSizes sizes of the interaction sites
12 blockStarts starts of the interaction sites

It is to be noted that #9 describes the class of interaction in which RNA-RNA corresponds to (0,255,0) (green), Protein-RNA to (0,0,255) (blue), and a multi RNA/Protein complex corresponds to (255,0,0) (red)

An interaction in RIF format (see minimal example) then corresponds to the following BED file

NC_000913.3 4400287 4400596 Hfq-dsrA    0   +   4400287 4400596 (255,0,0)   2   19,11   60,45
NC_000913.3 4400287 4400596 Hfq-rpoS    0   +   4400287 4400596 (255,0,0)   1   31  10
NC_000913.3 2025222 2025313 dsrA-Hfq    0   -   2025222 2025313 (255,0,0)   2   19,11   12,80
NC_000913.3 2025222 2025313 dsrA-rpoS   0   -   2025222 2025313 (255,0,0)   1   21  50
NC_000913.3 2866558 2867551 rpoS-Hfq    0   -   2866558 2867551 (255,0,0)   1   31  200
NC_000913.3 2866558 2867551 rpoS-dsrA   0   -   2866558 2867551 (255,0,0)   1   21  587
NC_000913.3 2313083 2313176 micF-lrp    0   +   2313083 2313176 (0,255,0)   2   8,10    25,55
NC_000913.3 932594  933089  lrp-micF    0   +   932594  933089  (0,255,0)   2   8,10    100,158

Examples

Additional Examples

Minimal Example

[{
    "version": "RIFv1.0",
    "ID": 1,
    "class": "RNA-RNA-Protein",
    "type": "basepairing",

    "evidence": [
        {
            "type": "experimental",
            "method": "gel shift assay",
            "data": {
                "URI": "https://journals.asm.org/doi/full/10.1128/JB.183.6.1997-2005.2001",
                "note": "Hfq and DsrA interact in vivo"
            }
        },
        {
            "type": "experimental",
            "method": "protein binding assay",
            "data": {
                "URI": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1370368/"
            }
        }
    ],

    "partners": [
        {
            "name": "Hfq",
            "symbol": "Hfq",
            "type": "polypeptide",
            "sequence_type": "protein",
            "genomic_coordinates": "NC_000913.3:+:4400288-4400596",
            "organism_name": "Escherichia coli K-12 MG1655",
            "organism_acc": "NC_000913.3",
            "local_sites": {
                "dsrA": [[60,78],[45,55]],
                "rpoS": [[10,40]]
            },
            "info": {
                "description": "RNA chaperone that binds small regulatory RNA (sRNAs) and mRNAs to facilitate mRNA translational regulation in response to envelope stress, environmental stress and changes in metabolite concentrations.",
                "sequence": "MAKGQSLQDPFLNALRRERVPVSIYLVNGIKLQGQIESFDQFVILLKNTVSQMVYKHAISTVVPSRPVSHHSNNAGGGTSSNYHHGSSAQNTSAQQDSEETE",
                "note": "https://www.ebi.ac.uk/pdbe/entry/pdb/5I21"
            }
        },
        {
            "name": "dsrA",
            "symbol": "dsrA",
            "type": "small_regulatory_ncRNA",
            "sequence_type": "rna",
            "genomic_coordinates": "NC_000913.3:-:2025223-2025313",
            "organism_name": "Escherichia coli K-12 MG1655",
            "organism_acc": "NC_000913.3",
            "local_sites": {
                "Hfq": [[12,30],[80,90]],
                "rpoS": [[50,70]]
            },
            "info": {
                "description": "DsrA small regulatory RNA; riboregulator of RpoS and H-NS production",
                "sequence": "AACGCATCGGATTTCCCGGTGTAACGAATTTTCAAGTGCTTCTTGCATTAGCAAGTTTGATCCCGACTCCTGCGAGTCGGGATTT",
                "structure": "...(((((((.....)))))))..(((((((...(((((.....)))))...)))))))((((((((((....)))))))))).."
            },

            "custom": {}
        },
        {
            "name": "rpoS",
            "symbol": "rpoS",
            "type": "mRNA",
            "sequence_type": "rna",
            "genomic_coordinates": "NC_000913.3:-:2866559-2867551",
            "organism_name": "Escherichia coli K-12 MG1655",
            "organism_acc": "NC_000913.3",
            "local_sites": {
                "Hfq": [[200,230]],
                "dsrA": [[587,607]]
            },
            "info": {
                "description": "RNA polymerase, sigma S (sigma 38) factor",
                "sequence": "TGAGTCAGAATACGCTGAAAGTTCATGATTTAAATGAAGATGCGGAATTTGATGAGAACGGAGTTGAGGTTTTTGACGAAAAGGCCTTAGTAGAACAGGAACCCAGTGATAACGATTTGGCCGAAGAGGAACTGTTATCGCAGGGAGCCACACAGCGTGTGTTGGACGCGACTCAGCTTTACCTTGGTGAGATTGGTTATTCACCACTGTTAACGGCCGAAGAAGAAGTTTATTTTGCGCGTCGCGCACTGCGTGGAGATGTCGCCTCTCGCCGCCGGATGATCGAGAGTAACTTGCGTCTGGTGGTAAAAATTGCCCGCCGTTATGGCAATCGTGGTCTGGCGTTGCTGGACCTTATCGAAGAGGGCAACCTGGGGCTGATCCGCGCGGTAGAGAAGTTTGACCCGGAACGTGGTTTCCGCTTCTCAACATACGCAACCTGGTGGATTCGCCAGACGATTGAACGGGCGATTATGAACCAAACCCGTACTATTCGTTTGCCGATTCACATCGTAAAGGAGCTGAACGTTTACCTGCGAACCGCACGTGAGTTGTCCCATAAGCTGGACCATGAACCAAGTGCGGAAGAGATCGCAGAGCAACTGGATAAGCCAGTTGATGACGTCAGCCGTATGCTTCGTCTTAACGAGCGCATACCTCGGTAGACACCCCGCTGGGTGGTGATTCCGAAAAAGCGTTGCTGGACATCCTGGCCGATGAAAAAGAGAACGGTCCGGAAGATACCACGCAAGATGACGATATGAAGCAGAGCATCGTCAAATGGCTGTTCGAGCTGAACGCCAAACAGCGTGAAGTGCTGGCACGTCGATTCGGTTTGCTGGGGTACGAAGCGGCAACACTGGAAGATGTAGGTCGTGAAATTGGCCTCACCCGTGAACGTGTTCGCCAGATTCAGGTTGAAGGCCTGCGCCGTTTGCGCGAAATCCTGCAAACGCAGGGGCTGAATATCGAAGCGCTGTTCCGCGAGTAA",
                "structure": "(((((((((((.........)))).))))))).........(((((((..((((.((((((..(((((((((((.....))))))))))).......((..(((.(((((((((......((.....))...))))))))).)))..)).....(((((((((.((((((....((((((..((((((..(((((((.....))))..)))....))).)))..)))))).......))))))....((((((((((....(((((((..(((((((((((..((((.....))))))))))))))).....(((((((((.....)))..(((.((((((((...))))))))....)))...))))))...))))).)))))))))))).(((((((..((((((...)).))))...))))))))))))))))...((((((....))))))((((....(((((...............))))).....))))...))).))).))))........(((((.((((...((((((.((((((.((.(((((((........))))....))))).))))))......))))))..(((((((....)))))))..))))))))).(((((((((((....))))).)))))).((((....((((((....)).))))...))))...(((((((((((...(((.(((((.............))))).))).....))).)))......((((((..(((......((((((((((((.((((.....))))(((...((((.((((...((((((((((..((((((((((((..........)))))).)))))).)))))((((((......))))))(((........)))...))))).)))).))))..)))....)))))))).))))..((((((....)))))))))..))))))..))))))))))))......"
            },

            "custom": {}
        }
    ]
}]

Implementation

C/C++

The implementation uses the RapidJSON library (https://rapidjson.org/). RapidJSON parses a json string into a 'Document', which makes it easy to manipulate.

Header:

#include "parser/parse.h" //parser; import/export
#include "parser/update.h" // updating documents
using namespace rapidjson;

Read a .json file:

std::string json=(read_jfile(path_to_your_json));
Document doc;
doc.Parse(json);

Validator:

json_check(*doc); // the object 'doc' is a valid json document.

Document schema;
schema.Parse(read_jfile(path_to_your_schema));
schema_validator(*doc, *schema); // the object 'doc' is valid for the given schema.

Write a document into a .json file:

write_json(&doc, path_to_directory, file_name);

Export a document to a .bed file:

export_bed(&doc, path_to_directory, file_name);

Basic file manipulations are handled by RapidJSON (see RapidJSON documentation: https://rapidjson.org/):

(doc[i]).HasMember("ID"); //checks that the i-th interaction of 'doc' has a member "ID".
int id=(document[i]["ID"]).GetInt(); // retrieves the ID of the i-th interaction.
doc[i]["ID"]=12; // sets the ID of the i-th interaction to 1.
std::string nm=(doc[i]["partners"][j]["name"]).GetString(); // retrieves the name of the j-th partner of the i-th interaction.
doc[i]["partners"][j]["name"]="Bbh"; // sets the name of the j-th partner of the i-th interaction to "Bbh".

Since an interaction is called by its position in 'doc', 'find_interaction' allows to retrieve the position of an interaction from its ID. To avoid problems, IDs within a single document are assumed to be unique:

int i=find_interaction(3);
std::string cl=(document[i]["class"]).GetString(); // retrieves the class of the interaction with "ID": 3.

A specific interaction can be removed:

int i=find_interaction(3);
remove_interaction(&doc, i); // removes from 'doc' the interaction with "ID": 3.

Or added:

Document otherdoc;
add_interaction(&doc, &((otherdoc[i])).GetValue()); // add to 'doc' the i-th interaction of 'otherdoc'

Specific interactions can be retrieved using 'get_interaction', via a string query:

Document sub1=get_interaction(&doc, "class=RNA-RNA") // New rapidjson document containing all interaction of 'doc' with "class": "RNA-RNA".
Document sub2=get_interaction(&doc, "class=RNA-RNA, RNA-Protein") // New rapidjson document containing all interaction of 'doc' with "class": "RNA-RNA" or "class": "RNA-Protein".
Document sub3=get_interaction(&doc, "class=RNA-RNA; partner=dsrA") // New rapidjson document containing all interaction of 'doc' with "class": "RNA-RNA" and "dsrA" as one of the partner.

JavaScript

At first, the required packages for the RIF module need to be installed.

cd ./js
npm install

The RIF module can be included in node.js using the require function by referencing to the rif.js file.

const rif = require('./rif.js');
var r = new rif(); // or var r = new rif('path/to/schema.json')

The RIF object can also be invoked by providing the schema file as a parameter. This is intended for validation against different schema (in future version).

For the basic functionality of reading and writing RIF files, the functions readRIF(RIFfile) and writeRIF(RIFfile) are provided.

Moreover, changeData(data) and changeSchema(schemaFile) allow changing the data and the schema, respectively. Direct access to the interaction data is provided using a data getter (e.g., r.data)

In addition, validateData(data) validates a data object against the schema, which is also called when importing RIF files using readRIF. In other words, data can only be read/imported when it a valid RIF file.

r.readRIF('./examples/RNA-RNA.json'); // import a RIF file
r.writeRIF('./RNA-RNA.json'); // write the RIF file
r.validateData(data); // validates `data` against the schema

For the retrieval of specific interactions, get allows different queries of the data. This includes queries in which single or multiple properties are defined. In doing so, this returns the interactions which match all provided properties.

r.get({"ID": 1}); // unique query, returns a single interaction that matches the ID
r.get({"class": "RNA-RNA"}); // returns all interactions matching the class property
r.get({"class": "RNA-RNA", "type": "basepairing"}); // returns all interactions matching the class and type property

In a similar manner, RIF can be queried for multiple interactions.

r.get([{"ID": "someid"}, {"ID": "anotherid"}]); // multiple queries

Other data manipulation is done with add and rm which add an interaction to the data and removes it, respectively. In the of adding an interaction, this requires an interaction data which suffices the schema, e.g.,

r.add({
	 "ID": "someid",
	 "version": "RIFv1.0",
    "class": "RNA-RNA",
    "type": "basepairing",
    "evidence": [
        {
            "type": "experimental",
            "method": "gel shift assay",
            "data": {
                "URI": "https://journals.asm.org/doi/full/10.1128/JB.183.6.1997-2005.2001",
                "note": "Hfq and DsrA interact in vivo"
            }
        }
    ],
    "partners": [
        {
            "name": "micF",
            "symbol": "micF",
            "type": "small_regulatory_ncRNA",
            "local_sites": {
                "lrp": [[25,32],[55,64]]
            }
        },
        {
            "name": "lrp",
            "symbol": "lrp",
            "type": "mRNA",
            "local_sites": {
                "micF": [[100,107],[158,167]]
            }
        }
    ]
})

It is to be noted that ID is determined automatically, but can also be set manually. However, this should be unique. Similarly, an interaction can be removed by querying for certain name/value pairs, e.g.,

r.rm({"ID": "someid"}); // removes interaction with ID=1
r.rm({"class": "RNA-RNA"}); // removes all interactions of class: RNA-RNA

In addition, specific properties can be modified using the mod routine which accepts the id of the interaction and the key/value pair.

r.mod(1,{"type": "Protein-RNA"}); // changes the type to "Protein-RNA" on interaction with ID=1

Finally, the interaction can exported to BED format using writeBED(filename)

Python

Get it

The python API can be installed from source via cloning the repository and:

pip install PythonAPI

You can test if the module was installed correctly using pytest:

pip install pytest
pytest --pyargs RIF

Loading and Parsing

Main functions are provided via the InteractionFile class. Using this it is possible to load a whole file of Interactions like:

from RIF.pRIF import InteractionFile

interaction_file = InteractionFile.load("/path/to/file")

It is then possible to iterate over the Interactions within this file

for interaction in interaction_file:
    print(interaction.interaction_id)

For large files it might be beneficial to not load them into memory at once. Thus, it is possible to parse entries in Interaction Files one after another using and Generator returned by the parse() function. This can be used for example to filter the file and construct an InteractionFile object only from a subset as shown below.

from RIF.pRIF  import InteractionFile

filtered_interactions = []
for interaction in InteractionFile.parse("/path/to/file"):
    if interaction.interaction_class == "RNA-RNA":
        filtered_interactions.append(interaction)

interaction_file = InteractionFile(filtered_interactions)

Validation

The validation happens automatically during actions like File creation, loading, or adding. It is possible to disable this via setting the corresponding validate flags to False. However, a user can also validate the object manually via:

interaction_file.validate()

Export

JSON

InteractionFile objects can be exported to the RNAinteraction Format using the export_json() function as follows:

from RIF.pRIF  import InteractionFile

interaction_file = InteractionFile.load("/path/to/file")
interaction_file.export_json("/new/file/path")
BED

It is also possible to export In Bed format using InteractionFile.export_bed() function in a similar way.

from RIF.pRIF  import InteractionFile

interaction_file = InteractionFile.load("/path/to/file")
interaction_file.export_bed("/new/file/path.bed")

Creating a File within Python

You can also create an InteractionFile object in pure python and export it to the json format. Using this approach it is easy to include the API into your python tool and write an export function. Keep in mind that json object are converted to classes in the python api. In contrast, Lists will stay Lists (except for the local and genomic coordinates).

However, lets start from the bottom and create an InteractionFile with a single hypothetical entry of an RNA-Protein interaction which was predicted using the tool RNAProt.

First we will import all necessary classes

from RIF.pRIF  import (
    Evidence,
    EvidenceData,
    Partner,
    GenomicCoordinates,
    LocalSite,
    RNAInteraction,
    InteractionFile
)

Afterwards, we will construct the Evidence objects and the evidence data.

evidence = Evidence(
        evidence_type="prediction",
        method="RNAProt",
        command="RNAProt predict --mode 2 --thr 2",
        data={
            "significance": {"p-value": 0.001}
        }
    )

The next step is the creation of Partner entries.

mrna_partner = Partner(
        name="Tumor protein P53",
        symbol="TP53",
        partner_type="mRNA",
        organism_acc="9606",
        organism_name="Homo sapiens",
        genomic_coordinates=GenomicCoordinates(
            chromosome="chr17",
            strand="-",
            start=7687490,
            end=7668421,
        ),
        local_sites={
            "ELAVL1": [
                LocalSite(
                    start=2125,
                    end=2160
                ),
                LocalSite(
                    start=2452,
                    end=2472
                )
            ]
        }
    )
    rbp_partner = Partner(
        name="ELAV-like protein 1",
        symbol="ELAVL1",
        partner_type="Protein",
        organism_acc="9606",
        organism_name="Homo sapiens",
        genomic_coordinates=GenomicCoordinates(
            chromosome="chr19",
            strand="-",
            start=8005641,
            end=7958573,
        ),
        local_sites={
            "Tumor protein P53": [
                LocalSite(
                    start=2125,
                    end=2160
                ),
                LocalSite(
                    start=2452,
                    end=2472
                )
            ]
        }
    )

The last step is quite simple as it only includes packing all together in an RNAInteraction and building the InteractionFile, which you can easily export.

interaction = RNAInteraction(
    interaction_id = 1,
    evidence=evidence,
    interaction_class="RNA-Protein",
    interaction_type="RNA binding",
    partners=[mrna_partner, rbp_partner]
)
interaction_file = InteractionFile([interaction])
interaction_file.export_json("testfile.json")

It is also possible to add or remove interactions. Adding is done via the add() method and removing via rm(). adding takes a single object of type RNAInteraction or an Iterable object of them as argument. Further, it always validates the file after adding the entries. You can disable this behavior via setting validate=False. In contrast, rm takes a single Interaction ID or a List of ids and removed them from the file.

interaction_file.add(interaction, validate=True)
interaction_file.rm(1)

Releases

Packages

Used by

Contributors

Languages