From 6b572ecef5d222efe1c81f80a010c3bfd0a58762 Mon Sep 17 00:00:00 2001 From: Gavin Huttley Date: Thu, 17 Jul 2025 09:18:36 +1000 Subject: [PATCH] MAINT: update to latest cogent3 [CHANGED] and bump version to 2025.7.17 --- pyproject.toml | 2 +- src/mutation_motif/__init__.py | 4 ++-- src/mutation_motif/aln_to_counts.py | 6 ++++-- src/mutation_motif/complement.py | 2 +- src/mutation_motif/log_lin.py | 2 +- src/mutation_motif/motif_count.py | 4 +++- src/mutation_motif/util.py | 8 +------- tests/test_control.py | 2 +- tests/test_entropy.py | 9 +++------ tests/test_motif_count.py | 5 ++--- tests/test_util.py | 2 -- 11 files changed, 19 insertions(+), 27 deletions(-) diff --git a/pyproject.toml b/pyproject.toml index 556ac11..87a3d9c 100644 --- a/pyproject.toml +++ b/pyproject.toml @@ -12,7 +12,7 @@ readme = "README.md" license = { file = "license.txt" } requires-python = ">=3.10,<3.14" dependencies = ["click", - "cogent3", + "cogent3>=2025.7.10a3", "kaleido", "numpy", "scipy", diff --git a/src/mutation_motif/__init__.py b/src/mutation_motif/__init__.py index 44668d7..7d4a7c6 100644 --- a/src/mutation_motif/__init__.py +++ b/src/mutation_motif/__init__.py @@ -1,4 +1,4 @@ -"""mutation_motif, software for naalyses of point mutations, see https://www.ncbi.nlm.nih.gov/pubmed/27974498""" +"""mutation_motif, software for analyses of point mutations, see https://www.ncbi.nlm.nih.gov/pubmed/27974498""" from warnings import filterwarnings @@ -6,4 +6,4 @@ filterwarnings("ignore", "invalid value encountered.*") __license__ = "BSD-3" -__version__ = "2025.01.28" +__version__ = "2025.7.17" diff --git a/src/mutation_motif/aln_to_counts.py b/src/mutation_motif/aln_to_counts.py index 2208dba..df147b1 100644 --- a/src/mutation_motif/aln_to_counts.py +++ b/src/mutation_motif/aln_to_counts.py @@ -3,8 +3,10 @@ import os import re +import cogent3 + from mutation_motif import motif_count, profile -from mutation_motif.util import just_nucs, load_from_fasta, makedirs +from mutation_motif.util import just_nucs, makedirs fn_suffixes = re.compile(r"\.(fa|fasta)\.*(gz|gzip|bz2)*$") @@ -44,7 +46,7 @@ def align_to_counts( direction = tuple(direction.split("to")) chosen_base = direction[0] - orig_seqs = load_from_fasta(os.path.abspath(align_path)) + orig_seqs = cogent3.load_aligned_seqs(os.path.abspath(align_path), moltype="dna") seqs = orig_seqs.array_seqs seqs = just_nucs(seqs) if not randomise: diff --git a/src/mutation_motif/complement.py b/src/mutation_motif/complement.py index cb9f474..b38b860 100644 --- a/src/mutation_motif/complement.py +++ b/src/mutation_motif/complement.py @@ -17,7 +17,7 @@ def _reverse_complement(table): rows = table.to_list() for row in rows: # we use the cogent3 DnaSeq object to do reverse complementing - seq = DNA.make_seq("".join(row[i] for i in pos_indices)) + seq = DNA.make_seq(seq="".join(row[i] for i in pos_indices)) seq = list(seq.rc()) for i, index in enumerate(pos_indices): row[index] = seq[i] diff --git a/src/mutation_motif/log_lin.py b/src/mutation_motif/log_lin.py index 4ebde49..48d7a6a 100644 --- a/src/mutation_motif/log_lin.py +++ b/src/mutation_motif/log_lin.py @@ -5,7 +5,7 @@ import pandas import statsmodels.api as sm import statsmodels.formula.api as smf -from cogent3.util.table import Table +from cogent3.core.table import Table from scipy.stats import chi2 _poisson = sm.families.Poisson() diff --git a/src/mutation_motif/motif_count.py b/src/mutation_motif/motif_count.py index a312e8b..5d281bd 100644 --- a/src/mutation_motif/motif_count.py +++ b/src/mutation_motif/motif_count.py @@ -1,10 +1,12 @@ from collections import Counter from itertools import product -from cogent3 import make_table +from cogent3 import get_moltype, make_table from mutation_motif.util import array_to_str +dna_alpha = get_moltype("DNA").most_degen_alphabet() + def profile_to_seq_counts(data, flank_size): """converts data to seqs and returns sequence counts""" diff --git a/src/mutation_motif/util.py b/src/mutation_motif/util.py index 9dc579a..406b6a1 100644 --- a/src/mutation_motif/util.py +++ b/src/mutation_motif/util.py @@ -11,8 +11,6 @@ import numpy from cogent3 import DNA, load_table, make_table, open_ -from cogent3.core.alignment import ArrayAlignment -from cogent3.parse.fasta import iter_fasta_records from cogent3.util.union_dict import UnionDict from pandas import read_json @@ -151,13 +149,9 @@ def is_valid(data): return (data >= 0).all() and (data < 4).all() -def load_from_fasta(filename): - seqs = list(iter_fasta_records(filename)) - return ArrayAlignment(data=seqs, moltype=DNA) - - def array_to_str(data): """convert numpy array back to DNA sequence""" + data = data.astype(numpy.uint8) return ["".join(DNA.alphabet.from_indices(v)) for v in data] diff --git a/tests/test_control.py b/tests/test_control.py index c945c44..2d05bcc 100755 --- a/tests/test_control.py +++ b/tests/test_control.py @@ -178,7 +178,7 @@ def test_get_random_indices(self): class TestAlignSnpAnnotation(TestCase): seqs = [("seq_0", "ATCAACATATAAAAAGGAAAT")] - d_aln = make_aligned_seqs(data=seqs, array_align=True, moltype=DNA).array_seqs + d_aln = make_aligned_seqs(seqs, moltype=DNA).array_seqs step = 3 slice_side = 7 direction = "AtoC" diff --git a/tests/test_entropy.py b/tests/test_entropy.py index f2360f7..3851c23 100755 --- a/tests/test_entropy.py +++ b/tests/test_entropy.py @@ -16,42 +16,39 @@ def ref_aln(DATA_DIR): return load_aligned_seqs( DATA_DIR / "entropy/ref.fasta", - array_align=True, moltype=DNA, ) @pytest.fixture(scope="session") def ref_data(ref_aln): - return ref_aln.seq_data + return ref_aln.array_seqs @pytest.fixture(scope="session") def ctl_aln(DATA_DIR): return load_aligned_seqs( DATA_DIR / "entropy/control.fasta", - array_align=True, moltype=DNA, ) @pytest.fixture(scope="session") def ctl_data(ctl_aln): - return ctl_aln.seq_data + return ctl_aln.array_seqs @pytest.fixture(scope="session") def gap_aln(DATA_DIR): return load_aligned_seqs( DATA_DIR / "entropy/gap.fasta", - array_align=True, moltype=DNA, ) @pytest.fixture(scope="session") def gap_data(gap_aln): - return gap_aln.seq_data + return gap_aln.array_seqs def test_validity(ref_data, gap_data): diff --git a/tests/test_motif_count.py b/tests/test_motif_count.py index ee247a9..3d71294 100644 --- a/tests/test_motif_count.py +++ b/tests/test_motif_count.py @@ -1,7 +1,6 @@ from unittest import TestCase, main -from cogent3 import DNA -from cogent3.core.alignment import ArrayAlignment +from cogent3 import DNA, make_aligned_seqs from mutation_motif.motif_count import ( get_combined_counts, @@ -36,7 +35,7 @@ def _get_seq_array(data): """returns [(n, seq), ...] as DenseArray""" - return ArrayAlignment(data=data, moltype=DNA).array_seqs + return make_aligned_seqs(data, moltype=DNA).array_seqs class TestMotifCount(TestCase): diff --git a/tests/test_util.py b/tests/test_util.py index 028f42e..2b2c313 100644 --- a/tests/test_util.py +++ b/tests/test_util.py @@ -18,7 +18,6 @@ def aln(DATA_DIR): return load_aligned_seqs( DATA_DIR / "just_nuc.fasta", - array_align=True, moltype=DNA, ) @@ -49,7 +48,6 @@ def test_just_nucs(aln): def d_aln(DATA_DIR): return load_aligned_seqs( DATA_DIR / "load_seqs_to_array.fasta", - array_align=True, moltype=DNA, )